A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
Even though flu season is ramping up, the real silent killer here at University of Wisconsin is academic fatigue. It may not give you a stuffy nose or a fever, but it’ll ruin your life just the same.