A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
MINNESOTA, USA — Isolated storms remain possible overnight into early Wednesday morning across southern MN and Northern MN. Storms will likely stay on the weaker side with a few heavy downpours ...
Even though flu season is ramping up, the real silent killer here at University of Wisconsin is academic fatigue. It may not give you a stuffy nose or a fever, but it’ll ruin your life just the same.